This cold, this cold to, its too cold to; oh, so cold.
Dispatch #1: July 1, 2025
I’ve been thinking about neo-reaction for months. How did it get here? Where did it go? So often circling the formalist, hyperstitionist prosthesis that grafted itself to the world-weapon, it appears to be flickering at the edges of experience. Where did it go, this rampant nü-blog style, hoisting its own word-weapon against the unreasoned cold? The lineage for this form of writing emerges out of modernist poetry: Land’s Trakl, Moldbug’s Cavafy -- mirror visions of a longing for decline, an exit from it all by the irrational phrase. We find this in Yarvin’s Urbit, “a machine for writing and evaluating Nock code”:
nock(a) *a
So too in Land’s Deleuzian mathematics, always returning to libidinal Zero by way of “popular numeracy.” The codes reduce and reduce into binary:
ATAGGTCATGAATCTACCGATTGCAGCTGCTATTCCTCGATGATCGCATGGGCTGTGATGGCATCGTATCCGATCGATTCGAGCGATTGCAGCTACGCTATTCCTCCGAGGGATTGCAGCTACGTCGCATCGGGCTCAGATGTAGGTCATGAATCTACCGATTGCATGACTTATCCACGGTAC TTCGACTC
Researching internet behavior is in large part a process of clicking-through. Hypertext is a sacred narrative device; we may analyze its sedimented layers in feints of digital theory. The whole form of the internet is shifting, which means it is a proper time for first histories of the blog form -- the hyperlink is an esoteric transmission, and can be read historically. The hyperlink is the saying-without-saying, the site of the networked discourse, of the archive.
nock(a) *a
- [a b c] [a [b c]]
-
- ?[a b] 0
- ?a 1
- +[a b] +[a b]
- +a 1 + a
- =[a a] 0
- =[a b] 1
-
- /[1 a] a
- /[2 a b] a
- /[3 a b] b
- /[(a + a) b] /[2 /[a b]]
- /[(a + a + 1) b] /[3 /[a b]]
- /a /a
-
- #[1 a b] a
- #[(a + a) b c] #[a [b /[(a + a + 1) c]] c]
- #[(a + a + 1) b c] #[a [/[(a + a) c] b] c]
- #a #a
-
- *[a [b c] d] [*[a b c] *[a d]] ”
So too in Land’s Deleuzian mathematics, always returning to libidinal Zero by way of “popular numeracy.” The codes reduce and reduce into binary:
- Virus is parasitic tic replicator code: an asignifying sequence of machinic data ATA ATA flow-break on/off, 1/0, yang/yin intrinsically destined for war. In place of mess message-content virodata is assembled bled from asignifying materials with CATA catalytic (or positively disproportionate) efficiency: intruder passcode, locational zIP-code, pseudogenomic substitute instructions, mutational junk (complex but latent segments) , and garbage (redundant scrapcrapcrapcrapcrapcrapcrapcrapcrapcrapcrapcrapcrap).
Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNARNA circuitry and endocellular computation).
ATAGGTCATGAATCTACCGATTGCAGCTGCTATTCCTCGATGATCGCATGGGCTGTGATGGCATCGTATCCGATCGATTCGAGCGATTGCAGCTACGCTATTCCTCCGAGGGATTGCAGCTACGTCGCATCGGGCTCAGATGTAGGTCATGAATCTACCGATTGCATGACTTATCCACGGTAC TTCGACTC
Ethnovirus targets brains Technovirus targets socioeconomic pro pro production pro processes. Infovirus targets digital 0100100100010111101000010011010101010101000 I 00110 10100100 I 01 00 computers 100 I 01001 0 1101001 010111 101000101010101010101001010100101011010100 100000010001011101010010010101001010010010101010100100010010010010010010010100100101011010100100100101011010101010101111010000100110101010101010001001101101010101001100100010001010101110100001010 (Hypervirus)
Researching internet behavior is in large part a process of clicking-through. Hypertext is a sacred narrative device; we may analyze its sedimented layers in feints of digital theory. The whole form of the internet is shifting, which means it is a proper time for first histories of the blog form -- the hyperlink is an esoteric transmission, and can be read historically. The hyperlink is the saying-without-saying, the site of the networked discourse, of the archive.
It is proposed that the proper way to analyze these systems is through the intellectual history of cybernetics, alongside critical archival theory and a love of art. As explored in a number of recent books -- especially Leif Weatherby’s Language Machines and Orit Halpern’s Beautiful Data -- the forms of thought developed by the overlapping worlds of cybernetics, structural linguistics, design, and neoliberal economics -- underpin our every modern technological interaction. You can feel it in the air -- crimes of the future stirring in blank states of night. Questions of determinism, of how something called artificial intelligence might feedback into everyday life. Orit Halpern writes of 24–25 March 1949:
The question today is of the integration of historical memory data, as first signaled by the hyperlink. [It’s earliest form was Vannevar Bush’s Memex]. Anduril and Palantir control their own records; we have no access; there are no longer norms. These are integrated platforms operating by the incessant logic of the commodity form, now enacted in the movement of trillion tokens. If we are to even momentarily comprehend the patterns of this information, we must, as Amelia Acker and Andrew Iliadis argue, develop “public archives for platform accountability,” a counter-archive against computational ontologies by which our most noble passions falter. This must be united with the principles of archival engineering, a newly proposed approach to digital archives developed by longtime Electronic Records Administration Kenneth Thibodeau, a man known for “development of the pioneering DoD 5015.02 standard for electronic records management and for creation of NARA's Electronic Records Archives System (ERA).” Without evidence, except that the Acting Archivist was Marco Rubio and the Presidential Cabinet is coordinating air strikes via Signal, it is my estimation that the DoD is no longer depositing its records according to best practices. The capture of the government’s platforms by a company with their own approaches to records management (data integration, a form of immediate back-propagation), means that their systems may only be read according to their own internal logics. A sort of immanent critique -- what Weatherby calls the dialectics of structuralism -- of the levels of meaning composing this machinic drive for entropy. This means compiling documentation of organizational structure, analyzing their approaches to ontology (both computational and philosophical), and reading the epistemological effects of their technologies on decision-making. This will be done through both the qualitative and quantitative tracking of patterned information across semiotic vectors. They are justifiably proud of their highly advanced approach to data management (cloud, tracing, privacy); they must be tracked in turn. The speed at which information is passed along satellite channels contains semantic/semiotic meaning that should be read for its evidentiary value. We might begin with the hyperlink, in relation to which we experience the desire, curiosity, and fear now so much more palpable in the age of the language model. The desire is for the message to soon precede the medium; the steadily accelerating heartbeat of artificial intelligence seeks too, to synchronize with this now-harnessed humanheart. We might turn to electronic music for confirmation and respite; we might play with the knobs.
We return to poetry; to the patterned energy of Modernism. It is off on webs of this network’s network, but, reading from Hugh Kenner’s The Pound Era, there is an ominous compulsion that situates Modernism at the foot of today’s political reactionaries, all of whom are indexed to an aesthetics of force:
Percy Wyndham Lewis. Composition in Red and Mauve. (1915). Pen, ink, chalk and gouache on paper. 34.7 x 24.5 cm. Museo Nacional Thyssen-Bornemisza, Madrid. Inv. no. 647 (1981.20)
In the Pound Era poets learned that the energy concentrated in exactness was a poetic resource...
Today’s reactionaries have what Anthony Burton has recently called a “fear of mimesis”: Land lets the fear wash over his expression and only speaks from the mouth of madness. Yarvin, the dark prince, cannot but express his fear as textual waste -- supposedly to publish a book, he has mainly released poetry. From a recent interview in the literary magazine HUIS CLOS:
Both Land and Yarvin love only the tic-like outburst of their own dismay at our Gaian systems. Rimbaud, Trakl, Pound, the lineage they claim in spite. The space between irony and esotericism today fades as, as another generation, we feel the connection between our tic-like practices and the vortex of the Earth alive. In this continuing series I will be speaking to my readings -- between the past and present of cybernetic logic, critical archival thought, and the analysis of reactionary aesthetic practices. Public archives for platform accountability -- Quelle tournure!
- In the Sixth Macy Conference, where many central figures in information theory, computing, and social science assembled, the arguments in attempting to understand memory were specific about trying to distill the difference between the processing elements that facilitate recognition, or perception, and the process by which information is recalled. A tense relationship thus continued between the role of memory as a site for storing stable records and the aspiration for memory as an operative function, the site of actual processing, and the seat of an active perceptual field.
The question today is of the integration of historical memory data, as first signaled by the hyperlink. [It’s earliest form was Vannevar Bush’s Memex]. Anduril and Palantir control their own records; we have no access; there are no longer norms. These are integrated platforms operating by the incessant logic of the commodity form, now enacted in the movement of trillion tokens. If we are to even momentarily comprehend the patterns of this information, we must, as Amelia Acker and Andrew Iliadis argue, develop “public archives for platform accountability,” a counter-archive against computational ontologies by which our most noble passions falter. This must be united with the principles of archival engineering, a newly proposed approach to digital archives developed by longtime Electronic Records Administration Kenneth Thibodeau, a man known for “development of the pioneering DoD 5015.02 standard for electronic records management and for creation of NARA's Electronic Records Archives System (ERA).” Without evidence, except that the Acting Archivist was Marco Rubio and the Presidential Cabinet is coordinating air strikes via Signal, it is my estimation that the DoD is no longer depositing its records according to best practices. The capture of the government’s platforms by a company with their own approaches to records management (data integration, a form of immediate back-propagation), means that their systems may only be read according to their own internal logics. A sort of immanent critique -- what Weatherby calls the dialectics of structuralism -- of the levels of meaning composing this machinic drive for entropy. This means compiling documentation of organizational structure, analyzing their approaches to ontology (both computational and philosophical), and reading the epistemological effects of their technologies on decision-making. This will be done through both the qualitative and quantitative tracking of patterned information across semiotic vectors. They are justifiably proud of their highly advanced approach to data management (cloud, tracing, privacy); they must be tracked in turn. The speed at which information is passed along satellite channels contains semantic/semiotic meaning that should be read for its evidentiary value. We might begin with the hyperlink, in relation to which we experience the desire, curiosity, and fear now so much more palpable in the age of the language model. The desire is for the message to soon precede the medium; the steadily accelerating heartbeat of artificial intelligence seeks too, to synchronize with this now-harnessed humanheart. We might turn to electronic music for confirmation and respite; we might play with the knobs.
We return to poetry; to the patterned energy of Modernism. It is off on webs of this network’s network, but, reading from Hugh Kenner’s The Pound Era, there is an ominous compulsion that situates Modernism at the foot of today’s political reactionaries, all of whom are indexed to an aesthetics of force:
In the Pound Era poets learned that the energy concentrated in exactness was a poetic resource...
- [quoting Buckminster Fuller]: “Therefore when nature has very large tasks to do, such as cohering the solar system or the universe, she...has compression operating in little remotely positioned islands, as high energy concentrations, such as the earth and other planets,...while cohering the whole system by comprehensive tension:--compression islands in a non-simultaneous universe of tension.”...
- We are dealing not with inflow but with homeomorphism, the domain of topology, systems of identical interconnectedness. (168-169)
Today’s reactionaries have what Anthony Burton has recently called a “fear of mimesis”: Land lets the fear wash over his expression and only speaks from the mouth of madness. Yarvin, the dark prince, cannot but express his fear as textual waste -- supposedly to publish a book, he has mainly released poetry. From a recent interview in the literary magazine HUIS CLOS:
-
In a way, all my work is a literary project. Literature is beyond the rational. My style is not just a rational appeal, it’s a seduction, it’s an invitation. Poetry is the extreme of this as it doesn’t work on the basis of the rational, but rather on the basis of the subconscious, the ambiguous, the irrational…There’s a world where people forget my political action and my philosophy but remember me just as a computer scientist and a poet.
Both Land and Yarvin love only the tic-like outburst of their own dismay at our Gaian systems. Rimbaud, Trakl, Pound, the lineage they claim in spite. The space between irony and esotericism today fades as, as another generation, we feel the connection between our tic-like practices and the vortex of the Earth alive. In this continuing series I will be speaking to my readings -- between the past and present of cybernetic logic, critical archival thought, and the analysis of reactionary aesthetic practices. Public archives for platform accountability -- Quelle tournure!